TAB3 Human qPCR Primer Pair (NM_152787)

SKU
HP217972
qSTAR qPCR primer pairs against Homo sapiens gene TAB3
$142.00
5 Days*
Specifications
Product Data
Locus ID 257397
Forward Sequence GCCCATTTCAGTGATACCAGGC
Reverse Sequence GCTAACCTCTCCATCCTTGCTC
ACCN NM_152787, NM_152787.1, NM_152787.2, NM_152787.3, NM_152787.4, BC032526, BC032526.1, BU849692, NM_152787.5
UniProt ID Q8N5C8
Synonyms MAP3K7IP3; NAP1
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Write Your Own Review
You're reviewing:TAB3 Human qPCR Primer Pair (NM_152787)
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.