Pdgfra Mouse Gene Knockout Kit (CRISPR)

SKU KN313036

Pdgfra - mouse gene knockout kit via CRISPR, HDR mediated

Product Data

• Format: 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
• Vector: GFP-puro
• Target Symbol: Pdgfra
• Locus ID: 18595
• Components:

  KN313036G1, Pdgfra gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGAGGACCAGAAAGACCTGG

  KN313036G2, Pdgfra gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGTGTGGATACATACCTGTG

  KN313036D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

  GE100003, scramble sequence in pCas-Guide vector

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data

• RefSeq: NM_001083316, NM_011058, NR_144636
• UniProt ID: P26618
• Synonyms: AI115593; CD140a; Pdgfr-2
• Summary: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
• Shipping: Ambient