Pdgfra Mouse Gene Knockout Kit (CRISPR)

SKU
KN313036
Pdgfra - mouse gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol Pdgfra
Locus ID 18595
Components

KN313036G1, Pdgfra gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGAGGACCAGAAAGACCTGG

KN313036G2, Pdgfra gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGTGTGGATACATACCTGTG

KN313036D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001083316, NM_011058, NR_144636
UniProt ID P26618
Synonyms AI115593; CD140a; Pdgfr-2
Summary This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
Shipping Ambient

More linear donor DNA can be ordered separately

Cat# KN313036D
Description 10 ug linear donor DNA for KN313036 kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN313036D
If you want to order 50ug, please order quantity of 5 for KN313036D

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:Pdgfra Mouse Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
GA203155 Pdgfra CRISPRa kit - CRISPR gene activation of mouse platelet derived growth factor receptor, alpha polypeptide 1 kit
$1,657.00
KN313036BN Pdgfra - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN313036LP Pdgfra - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN313036RB Pdgfra - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN513036 Pdgfra - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.