MET Human Gene Knockout Kit (CRISPR)

SKU
KN217003BN
MET - human gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Vector mBFP-Neo
Target Symbol MET
Locus ID 4233
Components

KN217003G1, MET gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCCCCCGCTGTGCTTGCACC

KN217003G2, MET gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CCTCGTGCTCCTGTTTACCT

KN217003BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000245, NM_001127500, NM_001324401, NM_001324402
UniProt ID P08581
Synonyms AUTS9; c-Met; DFNB97; HGFR; RCCP2
Summary This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
Shipping Ambient

More linear donor DNA can be ordered separately

Cat# KN217003BND
Description 10 ug linear donor DNA for KN217003BN kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN217003BND
If you want to order 50ug, please order quantity of 5 for KN217003BND

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:MET Human Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
GA102883 MET CRISPRa kit - CRISPR gene activation of human MET proto-oncogene, receptor tyrosine kinase 1 kit
$1,657.00
KN217003 MET - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217003LP MET - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217003RB MET - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN417003 MET - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.