APC Human Gene Knockout Kit (CRISPR)
$1,657.00
4 Weeks*
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
---|---|
Vector | mBFP-Neo |
Target Symbol | APC |
Locus ID | 324 |
Components |
KN211629G1, APC gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCGACCGGACCCGAGCCCA KN211629G2, APC gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGTGGTACAGAAGCGGGCAA KN211629BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_000038, NM_001127510, NM_001127511, NM_001354895, NM_001354896, NM_001354897, NM_001354898, NM_001354899, NM_001354900, NM_001354901, NM_001354902, NM_001354903, NM_001354904, NM_001354905, NM_001354906 |
UniProt ID | P25054 |
Synonyms | BTPS2; DP2; DP2.5; DP3; GS; PPP1R46 |
Summary | This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Dec 2019] |
Shipping | Ambient |
More linear donor DNA can be ordered separately
Cat# | KN211629BND |
Description | 10 ug linear donor DNA for KN211629BN kit |
Price | $515/€515 |
If you want to order 50ug, please order quantity of 5 for KN211629BND
Other selection marker is available for donor DNA.
Please contact
techsupport@origene.com
for a custom quote.

Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
GA100225 | APC CRISPRa kit - CRISPR gene activation of human APC regulator of WNT signaling pathway | 1 kit |
$1,657.00
|
|
KN211629 | APC - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN211629LP | APC - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN211629RB | APC - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN411629 | APC - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.