OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human PD1 (PDCD1) activation kit by CRISPRa

Be the first to review this product
SKU
GA103431
PDCD1 CRISPRa kit - CRISPR gene activation of human programmed cell death 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA806806 PD-1 (PDCD1) mouse monoclonal antibody, clone OTI4F10 (formerly 4F10) 100 ul
$447.00
RC210364 PD-1 / PDCD1 (Myc-DDK-tagged)-Human programmed cell death 1 (PD-1 / PDCD1)
10 ug
$450.00

Other products for "PDCD1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol PDCD1
Locus ID 5133
Components

GA103431G1, PD1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAGGTCAGGTTGAAGGGA

GA103431G2, PD1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGAGTGACAGAGGCAGTGC

GA103431G3, PD1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTGAGGAGGGGGTAGGACT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_005018
UniProt ID Q15116
Synonyms CD279; hPD-1; hPD-l; hSLE1; PD-1; PD1; SLEB2
Summary Programmed cell death protein 1 (PDCD1) is an immune-inhibitory receptor expressed in activated T cells; it is involved in the regulation of T-cell functions, including those of effector CD8+ T cells. In addition, this protein can also promote the differentiation of CD4+ T cells into T regulatory cells. PDCD1 is expressed in many types of tumors including melanomas, and has demonstrated to play a role in anti-tumor immunity. Moreover, this protein has been shown to be involved in safeguarding against autoimmunity, however, it can also contribute to the inhibition of effective anti-tumor and anti-microbial immunity. provided by RefSeq, Aug 2020
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN210364 PDCD1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN210364BN PDCD1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN210364LP PDCD1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN210364RB PDCD1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN410364 PDCD1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products