OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human PDX1 activation kit by CRISPRa

Be the first to review this product
SKU
GA102446
PDX1 CRISPRa kit - CRISPR gene activation of human pancreatic and duodenal homeobox 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA500038 Pdx1 mouse monoclonal antibody, clone OTI2A12 (formerly 2A12) 100 ul
$447.00
RC222354 PDX1 (Myc-DDK-tagged)-Human pancreatic and duodenal homeobox 1 (PDX1)
10 ug
$450.00

Other products for "PDX1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol PDX1
Locus ID 3651
Components

GA102446G1, PDX1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGGCCGCACTAAGAGGCT

GA102446G2, PDX1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTCAGGAGTGTGCAGCAAA

GA102446G3, PDX1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAACAAAAGCAGGTGCTCGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_000209, NM_013311
UniProt ID P52945
Synonyms GSF; IDX-1; IPF1; IUF1; MODY4; PAGEN1; PDX-1; STF-1
Summary The protein encoded by this gene is a transcriptional activator of several genes, including insulin, somatostatin, glucokinase, islet amyloid polypeptide, and glucose transporter type 2. The encoded nuclear protein is involved in the early development of the pancreas and plays a major role in glucose-dependent regulation of insulin gene expression. Defects in this gene are a cause of pancreatic agenesis, which can lead to early-onset insulin-dependent diabetes mellitus (IDDM), as well as maturity onset diabetes of the young type 4 (MODY4). provided by RefSeq, Aug 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN422354 PDX1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products