Human PDX1 activation kit by CRISPRa

SKU GA102446

PDX1 CRISPRa kit - CRISPR gene activation of human pancreatic and duodenal homeobox 1

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: PDX1
• Locus ID: 3651
• Components:

  GA102446G1, PDX1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGGCCGCACTAAGAGGCT

  GA102446G2, PDX1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTCAGGAGTGTGCAGCAAA

  GA102446G3, PDX1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAACAAAAGCAGGTGCTCGC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000209, NM_013311
• UniProt ID: P52945
• Synonyms: GSF; IDX-1; IPF1; IUF1; MODY4; PAGEN1; PDX-1; STF-1
• Summary: The protein encoded by this gene is a transcriptional activator of several genes, including insulin, somatostatin, glucokinase, islet amyloid polypeptide, and glucose transporter type 2. The encoded nuclear protein is involved in the early development of the pancreas and plays a major role in glucose-dependent regulation of insulin gene expression. Defects in this gene are a cause of pancreatic agenesis, which can lead to early-onset insulin-dependent diabetes mellitus (IDDM), as well as maturity onset diabetes of the young type 4 (MODY4). [provided by RefSeq, Aug 2017]