KRAS Human qPCR Primer Pair (NM_033360)

SKU HP231353

qSTAR qPCR primer pairs against Homo sapiens gene KRAS

Product Data

• Locus ID: 3845
• Forward Sequence: CAGTAGACACAAAACAGGCTCAG
• Reverse Sequence: TGTCGGATCTCCCTCACCAATG
• ACCN: NM_033360, NM_033360.1, NM_033360.2, BC013572, BC013572.2, BC010502, BC029545, BG258021, BT007153, NM_033360.4
• UniProt ID: P01116
• Synonyms: C-K-RAS; c-Ki-ras2; CFC2; K-Ras; K-RAS2A; K-RAS2B; K-RAS4A; K-RAS4B; KI-RAS; KRAS1; KRAS2; NS; NS3; RALD; RASK2
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient