Cyclophilin A (PPIA) Human qPCR Primer Pair (NM_021130)

SKU HP214065

qSTAR qPCR primer pairs against Homo sapiens gene PPIA

Product Data

• Locus ID: 5478
• Forward Sequence: GGCAAATGCTGGACCCAACACA
• Reverse Sequence: TGCTGGTCTTGCCATTCCTGGA
• ACCN: NM_021130, NM_021130.1, NM_021130.2, NM_021130.3, NM_021130.4, BC005320, BC005320.1, BC005982, BC005982.1, BC000689, BC003026, BC007104, BC013915, BC018843, BC037419, BC073992, BC093076, BC106030, BC137057, BC137058, BM806224, BM909285, BU786475, BX347265, BX408703, NM_021130.5
• UniProt ID: P62937
• Synonyms: CYPA; CYPH; HEL-S-69p
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient