Sting1 Mouse Gene Knockout Kit (CRISPR)

SKU
KN317757LP
Tmem173 - mouse gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Vector Luciferase-Puro
Target Symbol Sting1
Locus ID 72512
Components

KN317757G1, Sting1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AGCGGTGACCTCTGGGCCGT

KN317757G2, Sting1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGGCCAGCCTGATGATCCTT

KN317757LPD, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001289591, NM_001289592, NM_028261
UniProt ID Q3TBT3
Synonyms 2610307O08Rik; ERIS; Mita; MPYS; STING
Summary Facilitator of innate immune signaling that acts as a sensor of cytosolic DNA from bacteria and viruses and promotes the production of type I interferon (IFN-alpha and IFN-beta) (PubMed:18818105, PubMed:19433799, PubMed:19776740, PubMed:26229117, PubMed:26669264). Innate immune response is triggered in response to non-CpG double-stranded DNA from viruses and bacteria delivered to the cytoplasm (PubMed:18818105, PubMed:19433799, PubMed:19776740, PubMed:26229117, PubMed:26669264). Acts by binding cyclic dinucleotides: recognizes and binds cyclic di-GMP (c-di-GMP), a second messenger produced by bacteria, and cyclic GMP-AMP (cGAMP), a messenger produced by CGAS in response to DNA virus in the cytosol (PubMed:21947006, PubMed:23722158, PubMed:23258412, PubMed:23519410, PubMed:23910378). Upon binding of c-di-GMP or cGAMP, TMEM173/STING oligomerizes, translocates from the endoplasmic reticulum and is phosphorylated by TBK1 on the pLxIS motif, leading to recruitment and subsequent activation of the transcription factor IRF3 to induce expression of type I interferon and exert a potent anti-viral state (PubMed:25636800). In addition to promote the production of type I interferons, plays a direct role in autophagy (PubMed:30568238). Following cGAMP-binding, TMEM173/STING buds from the endoplasmic reticulum into COPII vesicles, which then form the endoplasmic reticulum-Golgi intermediate compartment (ERGIC) (By similarity). The ERGIC serves as the membrane source for WIPI2 recruitment and LC3 lipidation, leading to formation of autophagosomes that target cytosolic DNA or DNA viruses for degradation by the lysosome (By similarity). The autophagy- and interferon-inducing activities can be uncoupled and autophagy induction is independent of TBK1 phosphorylation (By similarity). Autophagy is also triggered upon infection by bacteria: following c-di-GMP-binding, which is produced by live Gram-positive bacteria, promotes reticulophagy (PubMed:29056340). Exhibits 2',3' phosphodiester linkage-specific ligand recognition: can bind both 2'-3' linked cGAMP (2'-3'-cGAMP) and 3'-3' linked cGAMP but is preferentially activated by 2'-3' linked cGAMP (PubMed:26300263). The preference for 2'-3'-cGAMP, compared to other linkage isomers is probably due to the ligand itself, whichs adopts an organized free-ligand conformation that resembles the TMEM173/STING-bound conformation and pays low energy costs in changing into the active conformation (By similarity). May be involved in translocon function, the translocon possibly being able to influence the induction of type I interferons (By similarity). May be involved in transduction of apoptotic signals via its association with the major histocompatibility complex class II (MHC-II) (PubMed:18559423).[UniProtKB/Swiss-Prot Function]
Shipping Ambient

More linear donor DNA can be ordered separately

Cat# KN317757LPD
Description 10 ug linear donor DNA for KN317757LP kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN317757LPD
If you want to order 50ug, please order quantity of 5 for KN317757LPD

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:Sting1 Mouse Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
GA209260 Tmem173 CRISPRa kit - CRISPR gene activation of mouse transmembrane protein 173 1 kit
$1,657.00
KN317757 Tmem173 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN317757BN Tmem173 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN317757RB Tmem173 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN517757 Tmem173 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.