Foxo3 Mouse Gene Knockout Kit (CRISPR)

SKU
KN306098
Foxo3 - mouse gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol Foxo3
Locus ID 56484
Components

KN306098G1, Foxo3 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCCGCTCTCTCCGCTCGAAG

KN306098G2, Foxo3 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTCGGCCACGCTCCTGTACG

KN306098D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_019740
UniProt ID Q9WVH4
Synonyms 1110048B16Rik; 2010203A17Rik; C76856; Fkhr2; FKHRL1; Foxo3a
Summary Transcriptional activator that recognizes and binds to the DNA sequence 5'-[AG]TAAA[TC]A-3' and regulates different processes, such as apoptosis and autophagy (PubMed:18054316, PubMed:18054315, PubMed:23805378). Acts as a positive regulator of autophagy in skeletal muscle: in starved cells, enters the nucleus following dephosphorylation and binds the promoters of autophagy genes, such as GABARAP1L, MAP1LC3B and ATG12, thereby activating their expression, resulting in proteolysis of skeletal muscle proteins (PubMed:18054316, PubMed:18054315, PubMed:25402684). Triggers apoptosis in the absence of survival factors, including neuronal cell death upon oxidative stress (By similarity). Participates in post-transcriptional regulation of MYC: following phosphorylation by MAPKAPK5, promotes induction of miR-34b and miR-34c expression, 2 post-transcriptional regulators of MYC that bind to the 3' UTR of MYC transcript and prevent its translation (By similarity). In response to metabolic stress, translocates into the mitochondria where it promotes mtDNA transcription (PubMed:23283301).[UniProtKB/Swiss-Prot Function]
Shipping Ambient

More linear donor DNA can be ordered separately

Cat# KN306098D
Description 10 ug linear donor DNA for KN306098 kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN306098D
If you want to order 50ug, please order quantity of 5 for KN306098D

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:Foxo3 Mouse Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
KN306098BN Foxo3 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN306098LP Foxo3 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN306098RB Foxo3 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN506098 Foxo3 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.