LRP1B Human Gene Knockout Kit (CRISPR)
$1,657.00
4 Weeks*
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
---|---|
Vector | GFP-puro |
Target Symbol | LRP1B |
Locus ID | 53353 |
Components |
KN224195G1, LRP1B gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CGGGATTATTGCCGATTGCC KN224195G2, LRP1B gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CGTGGGAGCCGACCGAGGTA KN224195D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_018557 |
UniProt ID | Q9NZR2 |
Synonyms | LRP-DIT; LRPDIT |
Summary | This gene encodes a member of the low density lipoprotein (LDL) receptor family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands. Disruption of this gene has been reported in several types of cancer. [provided by RefSeq, Jun 2016] |
Shipping | Ambient |
More linear donor DNA can be ordered separately
Cat# | KN224195D |
Description | 10 ug linear donor DNA for KN224195 kit |
Price | $515/€515 |
If you want to order 50ug, please order quantity of 5 for KN224195D
Other selection marker is available for donor DNA.
Please contact
techsupport@origene.com
for a custom quote.

Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
GA110009 | LRP1B CRISPRa kit - CRISPR gene activation of human LDL receptor related protein 1B | 1 kit |
$1,657.00
|
|
KN224195BN | LRP1B - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN224195LP | LRP1B - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN224195RB | LRP1B - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN424195 | LRP1B - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.