LRP1B Human Gene Knockout Kit (CRISPR)

SKU
KN224195
LRP1B - human gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol LRP1B
Locus ID 53353
Components

KN224195G1, LRP1B gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CGGGATTATTGCCGATTGCC

KN224195G2, LRP1B gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CGTGGGAGCCGACCGAGGTA

KN224195D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_018557
UniProt ID Q9NZR2
Synonyms LRP-DIT; LRPDIT
Summary This gene encodes a member of the low density lipoprotein (LDL) receptor family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands. Disruption of this gene has been reported in several types of cancer. [provided by RefSeq, Jun 2016]
Shipping Ambient

More linear donor DNA can be ordered separately

Cat# KN224195D
Description 10 ug linear donor DNA for KN224195 kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN224195D
If you want to order 50ug, please order quantity of 5 for KN224195D

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:LRP1B Human Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
GA110009 LRP1B CRISPRa kit - CRISPR gene activation of human LDL receptor related protein 1B 1 kit
$1,657.00
KN224195BN LRP1B - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN224195LP LRP1B - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN224195RB LRP1B - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN424195 LRP1B - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.