TRPM2 Human Gene Knockout Kit (CRISPR)

CAT#: KN216220

TRPM2 - human gene knockout kit via CRISPR

change donor?

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Symbol TRPM2
Locus ID 7226
Kit Components

KN216220G1, TRPM2 gRNA vector 1 in pCas-Guide vector, Target Sequence: GGAGATTGGAGACCATCCCC

KN216220G2, TRPM2 gRNA vector 2 in pCas-Guide vector, Target Sequence: GAGGAAAGCTGGCTCGGAGC

KN216220-D, donor vector containing Left and right homologous arms and GFP-puro functional cassette.
Homologous arm and GFP-puro sequences

pUC vector backbone in black; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001001188, NM_003307, NR_038257, XM_005261171, XM_011529736, XM_017028456, XM_017028457, XR_001754900, XR_001754901, XR_001754902
Synonyms EREG1; KNP3; LTrpC-2; LTRPC2; NUDT9H; NUDT9L1; TRPC7
Summary The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)
