CCR5 Human Gene Knockout Kit (CRISPR)

CAT#: KN216008

Reviews ()
Write a review

CCR5 - human gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation


  See Other Versions

USD 1,548.00


Availability*
2 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol CCR5
Locus ID 1234
Kit Components

KN216008G1, CCR5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TAATAATTGATGTCATAGAT

KN216008G2, CCR5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CTTCACATTGATTTTTTGGC

KN216008-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet

GGAGGATCGCTTGAGCCCAGGAGTTCGAGACCAGCCTGGGCAACATAGTGTGATCTTGTATCTATAAAAATAAACAAAATTAGCTTGGTGTGGTGGCGCCTGTAGTCCCCAGCCACTTGGAGGGGTGAGGTGAGAGGATTGCTTGAGCCCGGGATGGTCCAGGCTGCAGTGAGCCATGATCGTGCCACTGCACTCCAGCCTGGGCGACAGAGTGAGACCCTGTCTCACAACAACAACAACAACAACAAAAAGGCTGAGCTGCACCATGCTTGACCCAGTTTCTTAAAATTGTTGTCAAAGCTTCATTCACTCCATGGTGCTATAGAGCACAAGATTTTATTTGGTGAGATGGTGCTTTCATGAATTCCCCCAACAGAGCCAAGCTCTCCATCTAGTGGACAGGGAAGCTAGCAGCAAACCTTCCCTTCACTACAAAACTTCATTGCTTGGCCAAAAAGAGAGTTAATTCAATGTAGACATCTATGTAGGCAATTAAAAACCTATTGATGTATAAAACAGTTTGCATTCATGGAGGGCAACTAAATACATTCTAGGACTTTATAAAAGATCACTTTTTATTTATGCACAGGGTGGAACAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAAT

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000579, NM_001100168
UniProt ID P51681
Synonyms CC-CKR-5; CCCKR5; CCR-5; CD195; CKR-5; CKR5; CMKBR5; IDDM22
Summary This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]

Other Versions

Other products for "CCR5"
Frequently bought together (2)
Rabbit Polyclonal CCR5 Antibody
    • 100 ug

USD 484.00


CCR5 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant A
    • 10 ug

USD 477.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools