TGF beta 2 (TGFB2) Human Gene Knockout Kit (CRISPR)
$1,657.00
4 Weeks*
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
---|---|
Vector | mBFP-Neo |
Target Symbol | TGF beta 2 |
Locus ID | 7042 |
Components |
KN212624G1, TGF beta 2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGGACCAGTTCATGCGCAAG KN212624G2, TGF beta 2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TAGATGGAAATCACCTCCGG KN212624BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001135599, NM_003238, NR_138148, NR_138149 |
UniProt ID | P61812 |
Synonyms | G-TSF; LDS4; TGF-beta2 |
Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers. A chromosomal translocation that includes this gene is associated with Peters' anomaly, a congenital defect of the anterior chamber of the eye. Mutations in this gene may be associated with Loeys-Dietz syndrome. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016] |
Shipping | Ambient |
More linear donor DNA can be ordered separately
Cat# | KN212624BND |
Description | 10 ug linear donor DNA for KN212624BN kit |
Price | $515/€515 |
If you want to order 50ug, please order quantity of 5 for KN212624BND
Other selection marker is available for donor DNA.
Please contact
techsupport@origene.com
for a custom quote.

Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
GA104849 | TGFB2 CRISPRa kit - CRISPR gene activation of human transforming growth factor beta 2 | 1 kit |
$1,657.00
|
|
KN212624 | TGFB2 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN212624LP | TGFB2 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN212624RB | TGFB2 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN412624 | TGFB2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.