NADPH oxidase 4 (NOX4) Human Gene Knockout Kit (CRISPR)
$1,657.00
4 Weeks*
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
---|---|
Vector | GFP-puro |
Target Symbol | NADPH oxidase 4 |
Locus ID | 50507 |
Components |
KN208007G1, NADPH oxidase 4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAGCTGGCTCGCCAACGAAG KN208007G2, NADPH oxidase 4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCCTAGCCCGCCATCCTACC KN208007D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001143836, NM_001143837, NM_001291926, NM_001291927, NM_001291929, NM_001300995, NM_016931, NR_026571, NR_120406 |
UniProt ID | Q9NPH5 |
Synonyms | KOX; KOX-1; RENOX |
Summary | This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009] |
Shipping | Ambient |
More linear donor DNA can be ordered separately
Cat# | KN208007D |
Description | 10 ug linear donor DNA for KN208007 kit |
Price | $515/€515 |
If you want to order 50ug, please order quantity of 5 for KN208007D
Other selection marker is available for donor DNA.
Please contact
techsupport@origene.com
for a custom quote.

Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
GA109420 | NOX4 CRISPRa kit - CRISPR gene activation of human NADPH oxidase 4 | 1 kit |
$1,657.00
|
|
KN208007BN | NOX4 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN208007LP | NOX4 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN208007RB | NOX4 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN408007 | NOX4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.