NADPH oxidase 4 (NOX4) Human Gene Knockout Kit (CRISPR)

SKU
KN208007
NOX4 - human gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol NADPH oxidase 4
Locus ID 50507
Components

KN208007G1, NADPH oxidase 4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAGCTGGCTCGCCAACGAAG

KN208007G2, NADPH oxidase 4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCCTAGCCCGCCATCCTACC

KN208007D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001143836, NM_001143837, NM_001291926, NM_001291927, NM_001291929, NM_001300995, NM_016931, NR_026571, NR_120406
UniProt ID Q9NPH5
Synonyms KOX; KOX-1; RENOX
Summary This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
Shipping Ambient

More linear donor DNA can be ordered separately

Cat# KN208007D
Description 10 ug linear donor DNA for KN208007 kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN208007D
If you want to order 50ug, please order quantity of 5 for KN208007D

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:NADPH oxidase 4 (NOX4) Human Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
GA109420 NOX4 CRISPRa kit - CRISPR gene activation of human NADPH oxidase 4 1 kit
$1,657.00
KN208007BN NOX4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN208007LP NOX4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN208007RB NOX4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN408007 NOX4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.