OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

GBA Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN201614BN
GBA - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA803377 GBA mouse monoclonal antibody, clone OTI4G4 (formerly 4G4) 100 ul
$447.00
RC216061 GBA (Myc-DDK-tagged)-Human glucosidase, beta, acid (GBA), transcript variant 1
10 ug
$499.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "GBA or NM_000157"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Vector mBFP-Neo
Target Symbol GBA
Locus ID 2629
Components

KN201614G1, GBA gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CAGCATTGTCACAGTGCTTC

KN201614G2, GBA gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTTTTCAAGTCCTTCCAGAG

KN201614BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000157, NM_001005741, NM_001005742, NM_001005749, NM_001005750, NM_001171811, NM_001171812
UniProt ID P04062
Synonyms GBA1; GCB; GLUC
Summary This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jan 2010
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA101750 GBA CRISPRa kit - CRISPR gene activation of human glucosylceramidase beta 1 kit
$1,657.00
KN201614 GBA - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201614LP GBA - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201614RB GBA - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN401614 GBA - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

GBA Regulates EMT/MET and Chemoresistance in Squamous Cell Carcinoma Cells by Modulating the Cellular Glycosphingolipid Profile
Clark, Dickinson, Lima
Cells (2023) 12 (14) DOI: 10.3390/cells12141886
Cited by 9
AI Summary: OriGene's predesigned CRISPR/Cas9 plasmids targeting the GBA gene (KN201614BN) were used to generate GBA knockout squamous cell carcinoma cell lines, enabling the study of GBA's role in regulating EMT/MET, chemoresistance, and glycosphingolipid profiles.
Snippet: statistical analysis [27]. 2.6. GBA Knockout Cells HeLa and H1703 cells were from ATCC. GBA knockouts were generated using CRISPR/Cas9 using predesigned plasmids targeting the GBA loci (KN201614BN;Origene, Rockville, MD, USA) following the manufacturer’s guidelines. Briefly, 3 × 105 cells were seeded in each well of a six-well dish and allowed to attach. The following day, cells were transfe
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products