GBA Human Gene Knockout Kit (CRISPR)
$1,657.00
4 Weeks*
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
---|---|
Vector | mBFP-Neo |
Target Symbol | GBA |
Locus ID | 2629 |
Components |
KN201614G1, GBA gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CAGCATTGTCACAGTGCTTC KN201614G2, GBA gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTTTTCAAGTCCTTCCAGAG KN201614BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_000157, NM_001005741, NM_001005742, NM_001005749, NM_001005750, NM_001171811, NM_001171812 |
UniProt ID | P04062 |
Synonyms | GBA1; GCB; GLUC |
Summary | This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010] |
Shipping | Ambient |
More linear donor DNA can be ordered separately
Cat# | KN201614BND |
Description | 10 ug linear donor DNA for KN201614BN kit |
Price | $515/€515 |
If you want to order 50ug, please order quantity of 5 for KN201614BND
Other selection marker is available for donor DNA.
Please contact
techsupport@origene.com
for a custom quote.

Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
GA101750 | GBA CRISPRa kit - CRISPR gene activation of human glucosylceramidase beta | 1 kit |
$1,657.00
|
|
KN201614 | GBA - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN201614LP | GBA - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN201614RB | GBA - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN401614 | GBA - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.