GBA Human Gene Knockout Kit (CRISPR)

SKU
KN201614BN
GBA - human gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Vector mBFP-Neo
Target Symbol GBA
Locus ID 2629
Components

KN201614G1, GBA gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CAGCATTGTCACAGTGCTTC

KN201614G2, GBA gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTTTTCAAGTCCTTCCAGAG

KN201614BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000157, NM_001005741, NM_001005742, NM_001005749, NM_001005750, NM_001171811, NM_001171812
UniProt ID P04062
Synonyms GBA1; GCB; GLUC
Summary This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Shipping Ambient

More linear donor DNA can be ordered separately

Cat# KN201614BND
Description 10 ug linear donor DNA for KN201614BN kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN201614BND
If you want to order 50ug, please order quantity of 5 for KN201614BND

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:GBA Human Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
GA101750 GBA CRISPRa kit - CRISPR gene activation of human glucosylceramidase beta 1 kit
$1,657.00
KN201614 GBA - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201614LP GBA - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201614RB GBA - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN401614 GBA - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.