Human GBA activation kit by CRISPRa

SKU GA101750

GBA CRISPRa kit - CRISPR gene activation of human glucosylceramidase beta

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: GBA
• Locus ID: 2629
• Components:

  GA101750G1, GBA gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTGAACGAACAAGTGTCGC

  GA101750G2, GBA gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCCTTCCTCAAGTCTCAT

  GA101750G3, GBA gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGACGGTCACTCATGCAG

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000157, NM_001005741, NM_001005742, NM_001005749, NM_001005750, NM_001171811, NM_001171812
• UniProt ID: P04062
• Synonyms: GBA1; GCB; GLUC
• Summary: This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]