GBA Human Gene Knockout Kit (CRISPR)

CAT#: KN201614

GBA - human gene knockout kit via CRISPR

change donor?

USD 1,290.00


Availability*
2 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Symbol GBA
Locus ID 2629
Kit Components

KN201614G1, GBA gRNA vector 1 in pCas-Guide vector, Target Sequence: CAGCATTGTCACAGTGCTTC

KN201614G2, GBA gRNA vector 2 in pCas-Guide vector, Target Sequence: GTTTTCAAGTCCTTCCAGAG

KN201614-D, donor vector containing Left and right homologous arms and GFP-puro functional cassette.
Homologous arm and GFP-puro sequences

pUC vector backbone in black; Left arm sequence in blue; GFP-puro in green; Right arm in violet

TAGGGCAAAGACTGTCTTAAACATCTTGGTAGTGTCAGTATTTTGCACAGTGAAGTTTTTTTTTTTAAATTATATCAGCTTTATTTGTACCTTTTTGACATTTCTATCAAAAAAGAAGTGTGCCTGCTGTGGTTCCCATCCTCTGGGATTTAGGAGCCTCTACCCCATTCTCCATGCAAATCTGTGTTCTAGGCTCTTCCTAAAGTTGTCACCCATACATGCCCTCCAGAGTTTTATAGGGCATATAATCTGTAACAGATGAGAGGAAGCCAATTGCCCTTTAGAAATATGGCTGTGATTGCCTCACTTCCTGTGTCATGTGACGCTCCTAGTCATCACATGACCCATCCACATCGGGAAGCCGGAATTACTTGCAGGGCTAACCTAGTGCCTATAGCTAAGGCAGGTACCTGCATCCTTGTTTTTGTTTAGTGGATCCTCTATCCTTCAGAGACTCTGGAACCCCTGTGGTCTTCTCTTCATCTAATGACCCTGAGGGG TGGAATCCTGGCACTGGAATTTAATGAATGACAGACTCTCTTTGAATCCAGGGCCATCATGGCTCTTTGAGCAAGGCACAGATGGAGGGAGGGGTCGAAGTTGAAATGGGTGGGAAGAGTGGTGGGGAGCATCCTGATTTGGGGTGGGCAGAGAGTTGTCATCAGAAGGGTTGCAGGGAGAGCTGCACCCAGGTTTCTGTGGGCCTTGTCCTAATGAATGTGGGAGACCGGGCCATGGGCACCCAAAGGCAGCTAAGCCCTGCCCAGGAGAGTAGTTGAGGGGTGGAGAGGGGCTTGCTTTTCAGTCATTCCTCATTCTGTCCTCAGGAATGTCCCAAGCCTTTGAGTAGGGTAAGCATCATGGCTGGCAGCCTCACAGGATTGCTTCTACTTCAGGCAGTGTCGTGGGCATCAGGTGAGTGAGTCAAGGCAGTGGGGAGGTAGCACAGAGCCTCCCTTCTGCCTCATAGTCCTTTGGTAGCCTTCCAGTAAGCTGGTGG

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000157, NM_001005741, NM_001005742, NM_001005749, NM_001005750, NM_001171811, NM_001171812
Synonyms GBA1; GCB; GLUC
Summary This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents