OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CD20 (MS4A1) Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN201242LP
MS4A1 - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA800385 MS4A1 (CD20) mouse monoclonal antibody, clone OTI4B4 (formerly 4B4) 100 ul
$447.00
RC201242 MS4A1 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 3
10 ug
$300.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "CD20 or NM_021950"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Vector Luciferase-Puro
Target Symbol CD20
Locus ID 931
Components

KN201242G1, CD20 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCCCTATTGCTATGCAATC

KN201242G2, CD20 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ATCCTCCTGAAGAGTGGTTT

KN201242LPD, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_021950, NM_152866, NM_152867
UniProt ID P11836
Synonyms B1; Bp35; CD20; CVID5; LEU-16; MS4A2; S7
Summary This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. provided by RefSeq, Jul 2008
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA100658 MS4A1 CRISPRa kit - CRISPR gene activation of human membrane spanning 4-domains A1 1 kit
$1,657.00
KN201242 MS4A1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201242BN MS4A1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201242RB MS4A1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN401242 MS4A1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products