CD20 (MS4A1) Human Gene Knockout Kit (CRISPR)

SKU
KN201242LP
MS4A1 - human gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Vector Luciferase-Puro
Target Symbol CD20
Locus ID 931
Components

KN201242G1, CD20 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCCCTATTGCTATGCAATC

KN201242G2, CD20 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ATCCTCCTGAAGAGTGGTTT

KN201242LPD, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_021950, NM_152866, NM_152867
UniProt ID P11836
Synonyms B1; Bp35; CD20; CVID5; LEU-16; MS4A2; S7
Summary This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008]

More linear donor DNA can be ordered separately

Cat# KN201242LPD
Description 10 ug linear donor DNA for KN201242LP kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN201242LPD
If you want to order 50ug, please order quantity of 5 for KN201242LPD

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:CD20 (MS4A1) Human Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
GA100658 MS4A1 CRISPRa kit - CRISPR gene activation of human membrane spanning 4-domains A1 1 kit
$1,657.00
KN201242 MS4A1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201242BN MS4A1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201242RB MS4A1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN401242 MS4A1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.