CD20 (MS4A1) Human Gene Knockout Kit (CRISPR)
$1,657.00
4 Weeks*
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
---|---|
Vector | Luciferase-Puro |
Target Symbol | CD20 |
Locus ID | 931 |
Components |
KN201242G1, CD20 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCCCTATTGCTATGCAATC KN201242G2, CD20 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ATCCTCCTGAAGAGTGGTTT KN201242LPD, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_021950, NM_152866, NM_152867 |
UniProt ID | P11836 |
Synonyms | B1; Bp35; CD20; CVID5; LEU-16; MS4A2; S7 |
Summary | This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008] |
Shipping | Ambient |
More linear donor DNA can be ordered separately
Cat# | KN201242LPD |
Description | 10 ug linear donor DNA for KN201242LP kit |
Price | $515/€515 |
If you want to order 50ug, please order quantity of 5 for KN201242LPD
Other selection marker is available for donor DNA.
Please contact
techsupport@origene.com
for a custom quote.

Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
GA100658 | MS4A1 CRISPRa kit - CRISPR gene activation of human membrane spanning 4-domains A1 | 1 kit |
$1,657.00
|
|
KN201242 | MS4A1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN201242BN | MS4A1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN201242RB | MS4A1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN401242 | MS4A1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.