Human CD20 (MS4A1) activation kit by CRISPRa

SKU GA100658

MS4A1 CRISPRa kit - CRISPR gene activation of human membrane spanning 4-domains A1

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: MS4A1
• Locus ID: 931
• Components:

  GA100658G1, CD20 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATCAGTAGCTTCTGCTACCT

  GA100658G2, CD20 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTGCACCTCCTTCAGCTA

  GA100658G3, CD20 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGCCCCCACCCTATAAGC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_021950, NM_152866, NM_152867
• UniProt ID: P11836
• Synonyms: B1; Bp35; CD20; CVID5; LEU-16; MS4A2; S7
• Summary: This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008]