OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human CD20 (MS4A1) activation kit by CRISPRa

Be the first to review this product
SKU
GA100658
MS4A1 CRISPRa kit - CRISPR gene activation of human membrane spanning 4-domains A1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA800385 MS4A1 (CD20) mouse monoclonal antibody, clone OTI4B4 (formerly 4B4) 100 ul
$447.00
RC201242 MS4A1 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 3
10 ug
$300.00

Other products for "MS4A1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol MS4A1
Locus ID 931
Components

GA100658G1, CD20 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATCAGTAGCTTCTGCTACCT

GA100658G2, CD20 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTGCACCTCCTTCAGCTA

GA100658G3, CD20 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGCCCCCACCCTATAAGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_021950, NM_152866, NM_152867
UniProt ID P11836
Synonyms B1; Bp35; CD20; CVID5; LEU-16; MS4A2; S7
Summary This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN201242 MS4A1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201242BN MS4A1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201242LP MS4A1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201242RB MS4A1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN401242 MS4A1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products