Sequencing Primer, mGFP-R

CAT#: GE100125

Reviews ()
Write a review

Reverse primer to sequence targets cloned in expression vectors.



USD 66.00


Availability*
In Stock

Size
    • 1 nmol

Product images

Specifications

Product Data
Forward Sequence 5' GAAGCACTGGATGCCGTAGC 3'
Applicable Vectors PS100040, PS100071, PS100084, PS100093, PS100102, PS100113, PS100119, PS100121
Components 1 vial of lyophilized squencing primer (1 nmol, sufficient for 100 sequencing reactions)
Quality Control The primer has been tested to generate satisfactory squencing data on ABI 3730.
Storage Store at -20°C.
Stability The lyophilized and suspended primer is stable for one year from date of shipping when stored at -20°C

Documents

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.