Human PLAC8 activation kit by CRISPRa
$1,657.00
2 Weeks*
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
|---|---|
| Target Symbol | PLAC8 |
| Locus ID | 51316 |
| Components |
GA109735G1, PLAC8 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACTGATACGTCTTTTTAAT GA109735G2, PLAC8 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGTGTACCTAACACAATAT GA109735G3, PLAC8 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACTTCTGCTGGATTACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_001130715, NM_001130716, NM_016619 |
| UniProt ID | Q9NZF1 |
| Synonyms | C15; DGIC; onzin; PNAS-144 |
Write Your Own Review
| Product Manuals |
| FAQs |
| SDS |
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| KN212588 | PLAC8 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
| KN212588BN | PLAC8 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
| KN212588LP | PLAC8 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
| KN212588RB | PLAC8 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
| KN412588 | PLAC8 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.