Human MAP4K4 activation kit by CRISPRa

CAT#: GA106309

MAP4K4 CRISPRa kit - CRISPR gene activation of human mitogen-activated protein kinase kinase kinase kinase 4

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: MAP4K4
• Locus ID: 9448
• Kit Components:

  GA106309G1, MAP4K4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTGTGAGTGCGTTTCCGC

  GA106309G2, MAP4K4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTCCTGCCTGAGGAGGAA

  GA106309G3, MAP4K4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGCCTCCGCCTCCGCCTCC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_001242559, NM_001242560, NM_004834, NM_145686, NM_145687
• UniProt ID: O95819
• Synonyms: FLH21957; HEL-S-31; HGK; MEKKK4; NIK
• Summary: The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]