OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human Securin (PTTG1) activation kit by CRISPRa

Be the first to review this product
SKU
GA106157
PTTG1 CRISPRa kit - CRISPR gene activation of human PTTG1 regulator of sister chromatid separation, securin
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA322776 Anti-PTTG1 Rabbit Polyclonal Antibody
100 ul
$305.00
RC211038 PTTG1 (Myc-DDK-tagged)-Human pituitary tumor-transforming 1 (PTTG1)
10 ug
$450.00

Other products for "PTTG1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol PTTG1
Locus ID 9232
Components

GA106157G1, Securin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCTTAGGTCCTTTCCAT

GA106157G2, Securin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTACTTGGTGACCACGCCCA

GA106157G3, Securin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCACAACTCGCGGCCCAAT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001282382, NM_001282383, NM_004219
UniProt ID O95997
Synonyms EAP1; HPTTG; PTTG; TUTR1
Summary The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. provided by RefSeq, Sep 2013
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN411038 PTTG1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products