Human Securin (PTTG1) activation kit by CRISPRa

SKU GA106157

PTTG1 CRISPRa kit - CRISPR gene activation of human PTTG1 regulator of sister chromatid separation, securin

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: PTTG1
• Locus ID: 9232
• Components:

  GA106157G1, Securin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCTTAGGTCCTTTCCAT

  GA106157G2, Securin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTACTTGGTGACCACGCCCA

  GA106157G3, Securin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCACAACTCGCGGCCCAAT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001282382, NM_001282383, NM_004219
• UniProt ID: O95997
• Synonyms: EAP1; HPTTG; PTTG; TUTR1
• Summary: The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]