Human PNR (TAAR5) activation kit by CRISPRa

SKU GA106007

TAAR5 CRISPRa kit - CRISPR gene activation of human trace amine associated receptor 5

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: TAAR5
• Locus ID: 9038
• Components:

  GA106007G1, PNR gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGCTACCATAGAAAGCTGT

  GA106007G2, PNR gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTACACACCCACTACTTCC

  GA106007G3, PNR gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAAAACATAGGCTGAGCTT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_003967
• UniProt ID: O14804
• Synonyms: PNR
• Summary: Olfactory receptor specific for trimethylamine, a trace amine. Also activated at lower level by dimethylethylamine. Trimethylamine is a bacterial metabolite found in some animal odors, and to humans it is a repulsive odor associated with bad breath and spoiled food. This receptor is probably mediated by the G(s)-class of G-proteins which activate adenylate cyclase.[UniProtKB/Swiss-Prot Function]