Human TNFSF9 activation kit by CRISPRa

SKU GA105808

TNFSF9 CRISPRa kit - CRISPR gene activation of human TNF superfamily member 9

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: TNFSF9
• Locus ID: 8744
• Components:

  GA105808G1, TNFSF9 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTGCGGAATTTTCTCCACT

  GA105808G2, TNFSF9 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAAATTCCGCAGAGTCACG

  GA105808G3, TNFSF9 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCTGCTTGGCTACAAAAGG

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_003811
• UniProt ID: P41273
• Synonyms: 4-1BB-L; CD137L; TNLG5A
• Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This transmembrane cytokine is a bidirectional signal transducer that acts as a ligand for TNFRSF9/4-1BB, which is a costimulatory receptor molecule in T lymphocytes. This cytokine and its receptor are involved in the antigen presentation process and in the generation of cytotoxic T cells. The receptor TNFRSF9/4-1BB is absent from resting T lymphocytes but rapidly expressed upon antigenic stimulation. The ligand encoded by this gene, TNFSF9/4-1BBL, has been shown to reactivate anergic T lymphocytes in addition to promoting T lymphocyte proliferation. This cytokine has also been shown to be required for the optimal CD8 responses in CD8 T cells. This cytokine is expressed in carcinoma cell lines, and is thought to be involved in T cell-tumor cell interaction.[provided by RefSeq, Oct 2008]