Human ST8SIA4 activation kit by CRISPRa

SKU GA105350

ST8SIA4 CRISPRa kit - CRISPR gene activation of human ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: ST8SIA4
• Locus ID: 7903
• Components:

  GA105350G1, ST8SIA4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGACTATCTTGGAGCTCCC

  GA105350G2, ST8SIA4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCTTGGAGAGTAACGTCCC

  GA105350G3, ST8SIA4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCGCAAAGCCAATCACC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_005668, NM_175052
• UniProt ID: Q92187
• Synonyms: PST; PST1; SIAT8D; ST8SIA-IV
• Summary: The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]