OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human ST8SIA4 activation kit by CRISPRa

Be the first to review this product
SKU
GA105350
ST8SIA4 CRISPRa kit - CRISPR gene activation of human ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA370482 ST8SIA4 rabbit polyclonal antibody
100 ul
$310.00
RC215497 ST8SIA4 (Myc-DDK-tagged)-Human ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4), transcript variant 2
10 ug
$289.00 $300.00

Other products for "ST8SIA4"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol ST8SIA4
Locus ID 7903
Components

GA105350G1, ST8SIA4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGACTATCTTGGAGCTCCC

GA105350G2, ST8SIA4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCTTGGAGAGTAACGTCCC

GA105350G3, ST8SIA4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCGCAAAGCCAATCACC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_005668, NM_175052
UniProt ID Q92187
Synonyms PST; PST1; SIAT8D; ST8SIA-IV
Summary The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN208764 ST8SIA4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN208764BN ST8SIA4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN208764LP ST8SIA4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN208764RB ST8SIA4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN408764 ST8SIA4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products