Human Vimentin (VIM) activation kit by CRISPRa

SKU GA105122

VIM CRISPRa kit - CRISPR gene activation of human vimentin

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: VIM
• Locus ID: 7431
• Components:

  GA105122G1, Vimentin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCTTTAATGACTTCCACCA

  GA105122G2, Vimentin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGATCAGTGGTTTTTACCC

  GA105122G3, Vimentin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGATCACGATTGCACCGGGA

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_003380
• UniProt ID: P08670
• Synonyms: CTRCT30; HEL113
• Summary: This gene encodes a type III intermediate filament protein. Intermediate filaments, along with microtubules and actin microfilaments, make up the cytoskeleton. The encoded protein is responsible for maintaining cell shape and integrity of the cytoplasm, and stabilizing cytoskeletal interactions. This protein is involved in neuritogenesis and cholesterol transport and functions as an organizer of a number of other critical proteins involved in cell attachment, migration, and signaling. Bacterial and viral pathogens have been shown to attach to this protein on the host cell surface. Mutations in this gene are associated with congenital cataracts in human patients. [provided by RefSeq, Aug 2017]