Human SRD5A2 activation kit by CRISPRa

SKU GA104615

SRD5A2 CRISPRa kit - CRISPR gene activation of human steroid 5 alpha-reductase 2

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: SRD5A2
• Locus ID: 6716
• Components:

  GA104615G1, SRD5A2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTACTCTGTTGCCCAGGC

  GA104615G2, SRD5A2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCCCACAAATGTTAGAGGC

  GA104615G3, SRD5A2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTACCCTTCAGGCCAACCC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000348
• UniProt ID: P31213
• Synonyms: MGC138457
• Summary: This gene encodes a microsomal protein expressed at high levels in androgen-sensitive tissues such as the prostate. The encoded protein is active at acidic pH and is sensitive to the 4-azasteroid inhibitor finasteride. Deficiencies in this gene can result in male pseudohermaphroditism, specifically pseudovaginal perineoscrotal hypospadias (PPSH). [provided by RefSeq, Jul 2008]