Human Fc epsilon RI (FCER1A) activation kit by CRISPRa

SKU GA101543

FCER1A CRISPRa kit - CRISPR gene activation of human Fc fragment of IgE receptor Ia

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: FCER1A
• Locus ID: 2205
• Components:

  GA101543G1, Fc epsilon RI gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATCAAATACTGAACCATAC

  GA101543G2, Fc epsilon RI gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGCTTCTGACCTTGGCAAT

  GA101543G3, Fc epsilon RI gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCTTTTAAAGATCACTATC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_002001
• UniProt ID: P12319
• Synonyms: FCE1A; FcERI
• Summary: The immunoglobulin epsilon receptor (IgE receptor) is the initiator of the allergic response. When two or more high-affinity IgE receptors are brought together by allergen-bound IgE molecules, mediators such as histamine that are responsible for allergy symptoms are released. This receptor is comprised of an alpha subunit, a beta subunit, and two gamma subunits. The protein encoded by this gene represents the alpha subunit. [provided by RefSeq, Aug 2011]