Human eIF1A (EIF1AX) activation kit by CRISPRa

SKU GA101361

EIF1AX CRISPRa kit - CRISPR gene activation of human eukaryotic translation initiation factor 1A X-linked

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: EIF1AX
• Locus ID: 1964
• Components:

  GA101361G1, eIF1A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGTCTCCCGGTTTCACAAG

  GA101361G2, eIF1A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCCCACAACGCGTCTCCCT

  GA101361G3, eIF1A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCTAACAATAGGAGTCAGT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001412
• UniProt ID: P47813
• Synonyms: eIF-1A; eIF-4C; EIF1A; EIF1AP1; EIF4C
• Summary: This gene encodes an essential eukaryotic translation initiation factor. The protein is required for the binding of the 43S complex (a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5' end of capped RNA. [provided by RefSeq, Jul 2008]