Human ASCL1 activation kit by CRISPRa

CAT#: GA100310

ASCL1 CRISPRa kit - CRISPR gene activation of human achaete-scute family bHLH transcription factor 1

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: ASCL1
• Locus ID: 429
• Kit Components:

  GA100310G1, ASCL1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGAAAAGGCGGACGCACTC

  GA100310G2, ASCL1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGGGAGAAAGGAACGGGAGG

  GA100310G3, ASCL1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATAAACAGGCGGCGCGCTC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_004316
• UniProt ID: P50553
• Synonyms: ASH1; bHLHa46; HASH1; MASH1
• Summary: This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]