Human Androgen Receptor (AR) activation kit by CRISPRa

SKU GA100263

AR CRISPRa kit - CRISPR gene activation of human androgen receptor

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: AR
• Locus ID: 367
• Components:

  GA100263G1, Androgen Receptor gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATGCAACAGTTTGCGAGTC

  GA100263G2, Androgen Receptor gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGGGAGGGAAAAGGAGGT

  GA100263G3, Androgen Receptor gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGTGGGAAGGCAAGGAGGC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000044, NM_001011645, NM_001348061, NM_001348063, NM_001348064
• UniProt ID: P10275
• Synonyms: AIS; AR8; DHTR; HUMARA; HYSP1; KD; NR3C4; SBMA; SMAX1; TFM
• Summary: The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]