pCas-Guide-ROSA26

CAT#: GE100050

Reviews ()
Write a review

ROSA26 safe harbor gRNA vector, validated ROSA26 targeting sequence cloned in pCas-Guide vector



USD 517.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Function Rosa26 gRNA
Features
  • Validated all-in-one CRISPR vector targeting Mouse ROSA26 locus
  • ROSA26 target sequence: TTATTGCTTGTGATCCGCCT
  • Contains CMV-driven Cas9 and U6-driven ROSA26 gRNA expression
  • Targeted transgene insertion via CRISPR when cotransfect with pROSA26-Puro-DNR (after transgene is cloned)
  • Download vector sequence

Documents

Frequently bought together (4)
CAS9 mouse monoclonal antibody,clone OTI5E5
    • 100 ul

USD 417.00


Purified recombinant protein of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
    • 500 pmol

USD 138.00


Purified recombinant protein of mutant(D10A) of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
    • 500 pmol

USD 138.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools