Toggle Nav
My Cart
Search
Menu

pCas-Guide-ROSA26

main product photo
SKU
GE100050
ROSA26 safe harbor gRNA vector, validated ROSA26 targeting sequence cloned in pCas-Guide vector

Be the first to review this product
Datasheet SDS Vector Sequence
$650.00
In Stock*
Size

Frequently Bought Together (4)

TA811179 CAS9 mouse monoclonal antibody,clone OTI5E5 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
TP790148 Purified recombinant protein of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E.coli, sterile-filtered, suitable for cell culture 500 pmol
$138.00
TP790151 Purified recombinant protein of mutant(D10A) of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli 500 pmol
$152.00
Specifications
Product Data
Function Rosa26 gRNA
Features
  • Validated all-in-one CRISPR vector targeting Mouse ROSA26 locus
  • ROSA26 target sequence: TTATTGCTTGTGATCCGCCT
  • Contains CMV-driven Cas9 and U6-driven ROSA26 gRNA expression
  • Targeted transgene insertion via CRISPR when cotransfect with pROSA26-Puro-DNR (after transgene is cloned)
Download Vector Sequence
Storage Please store at -20°C for long term storage.
Stability The dried and the suspended DNA are stable for one year from date of shipping when stored at -20°C.
Shipping Ambient
Reviews
Write Your Own Review
You're reviewing:pCas-Guide-ROSA26
Your Rating
Documents
Product Manuals
FAQs
SDS
Resources
Vector Resources
Related Products
Check items to add to the cart or
  1. DH5α Chemically Competent E. coli Cells
    DH5α Chemically Competent E. coli Cells
    $160.00
    Add to Compare
  2. TurboFectin 8.0 Transfection Reagent (1 mL in 1 vial)
    TurboFectin 8.0 Transfection Reagent (1 mL in 1 vial)
    $530.00
    Add to Compare

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.