pLenti-Cas-Guide
SKU
GE100010
pLenti-Cas-Guide vector (with Cas9 expression) for genomic target sequence cloning (10 µg), GE100008 included.
- GE100010 is the updated version of GE100009.GE100010 is an improved version of GE100009.
$880.00
2 Weeks*
Specifications
| Product Data | |
| Function | All-in-One CRISPR/Cas9 vectors |
|---|---|
| Features |
|
| Download Vector Sequence | |
| OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. |
| Storage | Please store at -20°C for long term storage. |
| Stability | The dried and the suspended DNA are stable for one year from date of shipping when stored at -20°C. |
| Shipping | Ambient |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Citations
Leptin and insulin synergize with PIK3CA mutation to enhance PD-L1 mediated immunosuppression in thyroid cancer
Kainan, Yuerong, Runsheng et al
Exp Cell Res (2024)
Kainan, Yuerong, Runsheng et al
Exp Cell Res (2024)
Cited by 3
AI Summary: OriGene’s pLenti-Cas-Guide vector (GE100010) was used to clone sgRNAs for CRISPR knockout experiments, enabling the targeted gene editing essential for investigating the roles of leptin, insulin, and PIK3CA mutation in thyroid cancer immunosuppression.
Snippet: nd each sgRNA was cloned into pLenti-Cas-Guide vector (GE100010, OriGene). The sgRNA sequences are as follows. Mouse LEP-R: GAGUCAUCGGUUGUGUUCGG;mouse IR: UGUUCCGGAUGUCCAUACCA;Human PIK3CA-1: UCACCUGAUGAUGGUCGUGG;Human PIK3CA-2: CCCCACAGUUCACCUGAUGA. Lentivirus was packaged in HEK293T cells and infected at MOI = 5
Loss of tet methyl cytosine dioxygenase 3 (TET3) enhances cardiac fibrosis via modulating the DNA damage repair response
Rath, Nyamsuren, Tampe et al
Clin Epigenetics (2024) 16 (1), 119 DOI: 10.1186/s13148-024-01719-6
Rath, Nyamsuren, Tampe et al
Clin Epigenetics (2024) 16 (1), 119 DOI: 10.1186/s13148-024-01719-6
Cited by 13
AI Summary: OriGene products contributed to this study by providing the pLenti-Cas9-Guide plasmid (OriGene GE100010), which was used to generate TET3-targeting single-guide RNAs (sgRNAs) for CRISPR/Cas9-mediated gene editing in cardiac fibroblasts.
Snippet: … Guided RNAs targeting exon 10 and exon 11 of the TET3 gene were designed, and off-target binding effects were minimized on the basis of scores obtained on the online tool Blueheronbio (OriGene, Herford, Germany). The single-guide RNA (sgRNA) sequences were inserted into the pLenti-Cas9-Guide plasmid (OriGene GE100010, Herford, Germany) with BamHI and BsmBI restriction sites to gener
LRP5 competes for SPOP binding to enhance tumorigenesis mediated by Daxx and PD-L1 in prostate cancer
Gan, Qu, Zhang et al
Exp Cell Res (2023) 434 (1), 113857 DOI: 10.1016/j.yexcr.2023.113857
Gan, Qu, Zhang et al
Exp Cell Res (2023) 434 (1), 113857 DOI: 10.1016/j.yexcr.2023.113857
Cited by 5
AI Summary: OriGene’s pLenti-Cas-Guide vector (GE100010) was used to clone sgRNAs for gene editing experiments in this study investigating the roles of SPOP and LRP5 in prostate cancer.
Snippet: Each sgRNA was cloned into pLenti-Cas-Guide vector (GE100010, OriGene)
TET3 IMPACTS CARDIAC FIBROSIS PARTIALLY VIA REGULATION OF DNA DAMAGE RESPONSE
Rath
Georg-August-University Göttingen (2022)
Rath
Georg-August-University Göttingen (2022)
Cited by 2
Snippet: CRISPR/Cas9 Origene GE100010 2.5 μg
Schistosoma mansoni α-N-acetylgalactosaminidase (SmNAGAL) regulates coordinated parasite movement and egg production
Hulme, Geyer, Forde-Thomas et al
PLoS Pathog (2022) 18 (1), e1009828 DOI: 10.1371/journal.ppat.1009828
Hulme, Geyer, Forde-Thomas et al
PLoS Pathog (2022) 18 (1), e1009828 DOI: 10.1371/journal.ppat.1009828
Cited by 32
AI Summary: OriGene's pLenti-Cas-Guide construction Kit (GE100010) was used to assemble CRISPR/Cas9 plasmid constructs for gene editing experiments that demonstrated the role of SmNAGAL in Schistosoma mansoni movement and egg production.
Snippet: ry for Cas9 function) served as a non-targeting control (5´–GCA CUA CCA GAG CUA ACU CA– 3´). CRISPR/Cas9 plasmid constructs were assembled using the pLenti-Cas-Guide construction Kit (GE100010, OriGene, Maryland, USA) and each sgRNA was ligated into the pLenti-Cas-sgRNA backbone as per the manufacturer’s instructions. Expression of the sgRNA (SmNAGALX1, SmNAGALX2 or Scramble containing pla
Knockdown of C3G Mitigates Post-Infarct Remodeling Via Regulation of ERK1/2, Bcl-2 and Bax in Rat Myocardial Cells
LI, Deng, Hu et al
Research Square (2021)
LI, Deng, Hu et al
Research Square (2021)
Snippet: were designed (http://www.e-crisp.org/E-CRISP/) [7] and cloned respectively into pLenti-Cas-Guide lentiviral vector (Origene Co., Ltd, Rockville MD, USA). RT-PCR (reverse transcription polymerase chain reaction) and protein
Showing 1-6 of 12 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
