Tnf Mouse qPCR Primer Pair (NM_013693)

CAT#: MP217748

Reviews ()
Write a review

qSTAR qPCR primer pairs against Mus musculus gene Tnf

 Cited in 3 publications.

USD 100.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 21926
Forward Sequence GGTGCCTATGTCTCAGCCTCTT
Reverse Sequence GCCATAGAACTGATGAGAGGGAG
Accession No BC117057, NM_001278601, NM_013693, BC137720, BY167004
Synonyms DIF; TNF-a; TNF-alpha; Tnfa; TNFalpha; Tnfsf1a; TNFSF2; Tnlg1f
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.

Citations (3)

Frequently bought together (2)
Biotinylated Anti-Murine TNF-a Goat Polyclonal Antibody
    • 50 ug

USD 275.00


Tnf (Myc-DDK-tagged) - Mouse tumor necrosis factor (Tnf)
    • 10 ug

USD 330.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones