Tnf Mouse qPCR Primer Pair (NM_013693)

CAT#: MP217748

qSTAR qPCR primer pairs against Mus musculus gene Tnf



SensiMix SYBR Master Mix

USD 142.00

In Stock*

Size
    • 200 reactions

Product Images

Frequently bought together (4)
First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 165.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00


Tnf (Myc-DDK-tagged) - Mouse tumor necrosis factor (Tnf)
    • 10 ug

USD 450.00


TNF-α Rabbit pAb
    • 100 ul

USD 278.00

Specifications

Product Data
Gene ID 21926
Forward Sequence GGTGCCTATGTCTCAGCCTCTT
Reverse Sequence GCCATAGAACTGATGAGAGGGAG
Accession No BC117057, NM_013693, NM_013693.1, NM_013693.2, NM_013693.3, BC137720, BY167004
UniProt ID P06804
Synonyms DI; DIF; Tn; TNF-; TNF-a; TNF-alpha; Tnfa; TNFalpha; Tnfs; Tnfsf1a; TNFSF2; Tnlg1f
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.