Tnf Mouse qPCR Primer Pair (NM_013693)
USD 142.00
2 Weeks*
Size
Product Images
Frequently bought together (4)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
USD 305.00
Other products for "Tnf"
Specifications
Product Data | |
Gene ID | 21926 |
Forward Sequence | GGTGCCTATGTCTCAGCCTCTT |
Reverse Sequence | GCCATAGAACTGATGAGAGGGAG |
Accession No | BC117057, NM_013693, NM_013693.1, NM_013693.2, NM_013693.3, BC137720, BY167004 |
UniProt ID | P06804 |
Synonyms | DI; DIF; Tn; TNF-; TNF-a; TNF-alpha; Tnfa; TNFalpha; Tnfs; Tnfsf1a; TNFSF2; Tnlg1f |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.