Nr3c1 Mouse qPCR Primer Pair (NM_008173)

SKU MP209118

qSTAR qPCR primer pairs against Mus musculus gene Nr3c1

Product Data

• Locus ID: 14815
• Forward Sequence: TGGAGAGGACAACCTGACTTCC
• Reverse Sequence: ACGGAGGAGAACTCACATCTGG
• ACCN: BC129912, BC129913, NM_008173, NM_008173.1, NM_008173.2, NM_008173.3, BC008154, BC016462, BQ176909, BY232938, NM_008173.4
• Synonyms: GR; Grl-1; Grl1
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient