Mmp10 Mouse qPCR Primer Pair (NM_019471)

SKU MP207882

qSTAR qPCR primer pairs against Mus musculus gene Mmp10

Product Data

• Locus ID: 17384
• Forward Sequence: TGCTGCCTATGAGGCTCACAAC
• Reverse Sequence: GGAGGAAAACCGAGAGTGTGGA
• ACCN: BC130027, NM_019471, NM_019471.1, NM_019471.2, NM_019471.3
• UniProt ID: O55123
• Synonyms: AV377895; MMP-10; SL-2
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient