Il6 Mouse qPCR Primer Pair (NM_031168)

CAT#: MP206798

Reviews ()
Write a review

qSTAR qPCR primer pairs against Mus musculus gene Il6



SensiMix SYBR Master Mix

USD 142.00

2 Weeks*

Size
    • 200 reactions

Product images

Frequently bought together (3)
Il6 (Myc-DDK-tagged) - Mouse interleukin 6 (Il6)
    • 10 ug

USD 450.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 165.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00

Specifications

Product Data
Gene ID 16193
Forward Sequence TACCACTTCACAAGTCGGAGGC
Reverse Sequence CTGCAAGTGCATCATCGTTGTTC
Accession No BC132458, NM_031168, NM_031168.1, NM_031168.2, BC138766, BC145409
UniProt ID P08505
Synonyms Il; Il-6
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.