Itgae Mouse qPCR Primer Pair (NM_008399)
$142.00
5 Days*
| Product Data | |
| Locus ID | 16407 |
|---|---|
| Forward Sequence | GAAGTGGAACGGAGGGTCCTTT |
| Reverse Sequence | GTCTGGAACTCGTAGGTGACCT |
| ACCN | NM_008399, NM_008399.1, NM_008399.2, BC150690, BF453582, NM_008399.3 |
| UniProt ID | Q60677 |
| Synonyms | A530055J10; alpha-E1; alpha-M290; aM290; CD103 |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Write Your Own Review
| Product Manuals |
| FAQs |
Related Products
Check items to add to the cart or
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.