Exog Mouse qPCR Primer Pair (NM_172456)
$142.00
5 Days*
| Product Data | |
| Locus ID | 208194 |
|---|---|
| Forward Sequence | TTGTCGTGAGCTGACGGAGAGA |
| Reverse Sequence | GCCACGTTGTCCTCACCAATCA |
| ACCN | BC119024, NM_172456, NM_172456.1, NM_172456.2, NM_172456.3, BC052171, BC059920, BC064730, BC094589, BC144729, BI135003, BY113415, NM_172456.4 |
| UniProt ID | Q8C163 |
| Synonyms | AW557704; Endogl1; Endogl2; Engl; ENGL-a; ENGL-B; Engla; Englb |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Write Your Own Review
| Product Manuals |
| FAQs |
Related Products
Check items to add to the cart or
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.