Enpp1 Mouse qPCR Primer Pair (NM_008813)

CAT#: MP204083

qSTAR qPCR primer pairs against Mus musculus gene Enpp1

Specifications

Product Data

• Gene ID: 18605
• Forward Sequence: ACCCTCAGTGGCAACTTGCGTT
• Reverse Sequence: TGCTTGAAGGCAGGTCCATAGC
• Accession No: NM_008813, NM_008813.1, NM_008813.2, NM_008813.3, NM_008813.4, BC050011, BC160371
• Synonyms: 4833416E15Rik; AI428932; C76301; CD203c; E-N; E-NPP 1; E-NPP1; Ly-4; Ly-41; M6S1; N; NPP1; Npps; P; PC-; PC-1; Pca; Pca-1; Pd; Pdnp1; ttw; twy
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.