Ccnh Mouse qPCR Primer Pair (NM_023243)
$142.00
5 Days*
| Product Data | |
| Locus ID | 66671 |
|---|---|
| Forward Sequence | ACTTGCCTGTCACAGTTACTGGA |
| Reverse Sequence | GAATGACACCGCTCCAGCTTCT |
| ACCN | BC038861, NM_023243, NM_023243.1, NM_023243.2, NM_023243.3, NM_023243.4, NM_023243.5, NM_023243.6, BM899601, BQ032543, BY767531 |
| UniProt ID | Q61458 |
| Synonyms | 6330408H09Rik; AI661354; AV102684; AW538719 |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Write Your Own Review
| Product Manuals |
| FAQs |
Related Products
Check items to add to the cart or
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.