PSMA4 Human qPCR Primer Pair (NM_002789)

SKU HP231944

qSTAR qPCR primer pairs against Homo sapiens gene PSMA4

Product Data

• Locus ID: 5685
• Forward Sequence: CTTGTGAGCAGTTGGTTACAGCG
• Reverse Sequence: AGCCATAGTGCTTATCCCAGCC
• ACCN: NM_002789, NM_002789.1, NM_002789.2, NM_002789.3, NM_002789.4, NM_002789.5, BC005361, BC005361.1, BC047667, BC093069, BC001490, BC022445, BC022817, BC030529, BC056249, BF589105, BG208993, BG528289, BG616186, BG772003, BT009784, BU188756, BU930105
• UniProt ID: P25789
• Synonyms: HC9; HsT17706; PSC9
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient