NSP3 (SH2D3C) Human qPCR Primer Pair (NM_170600)
$142.00
5 Days*
| Product Data | |
| Locus ID | 10044 |
|---|---|
| Forward Sequence | CCTTCAGCAGTGGAGGTAGACC |
| Reverse Sequence | GGAGAACTTCACATAGTCGCTGC |
| ACCN | BC032365, NM_170600, NM_170600.1, NM_170600.2, BC032365.1, BC027962, BC027962.1, BI912337, BX647905 |
| UniProt ID | Q8N5H7 |
| Synonyms | CHAT; NSP3; PRO34088; SHEP1 |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Write Your Own Review
| Product Manuals |
| FAQs |
Related Products
Check items to add to the cart or
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.