TM9SF1 Human qPCR Primer Pair (NM_006405)

SKU HP227192

qSTAR qPCR primer pairs against Homo sapiens gene TM9SF1

Product Data

• Locus ID: 10548
• Forward Sequence: ACTGTTGGAGGCTTCCTGCCTT
• Reverse Sequence: ACACTCAGCAGGATGGCGAAGA
• ACCN: NM_006405, NM_006405.1, NM_006405.2, NM_006405.3, NM_006405.4, NM_006405.5, NM_006405.6, BC010856, BC010856.2, BM922952, BX161390, BX161494, NM_006405.7
• UniProt ID: O15321
• Synonyms: HMP70; MP70
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient