KLC1 Human qPCR Primer Pair (NM_182923)

SKU HP226891

qSTAR qPCR primer pairs against Homo sapiens gene KLC1

Product Data

• Locus ID: 3831
• Forward Sequence: CGGAAGTCACTGGAGATGTTGG
• Reverse Sequence: CTTCTCGGACTCCACAGCATTC
• ACCN: NM_182923, NM_182923.1, NM_182923.2, NM_182923.3, BC008881, BC008881.2, BK000678, BK000679, BK000680, BK000681, BK000682, BK000683, BK000684, BK001163, BK001164, BK001165, BK001166, BK001167, BK001168, BK001169, BK001170, BK001171, BK001172, BM988840, BP274336, BP396130, BQ002171
• UniProt ID: Q07866
• Synonyms: KLC; KNS2; KNS2A
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient