beta V Tubulin (TUBB) Human qPCR Primer Pair (NM_178014)

SKU
HP218747
qSTAR qPCR primer pairs against Homo sapiens gene TUBB
$142.00
5 Days*
Specifications
Product Data
Locus ID 203068
Forward Sequence CTGGACCGCATCTCTGTGTACT
Reverse Sequence GCCAAAAGGACCTGAGCGAACA
ACCN NM_178014, NM_178014.1, NM_178014.2, BC013374, BC013374.2, BC001002, BC001896, BC001938, BC002347, BC005838, BC007605, BC015889, BC019924, BC020946, BC021909, BC029323, BC062532, BC070326, BC103746, BE245819, BQ019614, BU557299, NM_178014.4
UniProt ID P07437
Synonyms CDCBM6; CSCSC1; M40; OK/SW-cl.56; TUBB1; TUBB5
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Write Your Own Review
You're reviewing:beta V Tubulin (TUBB) Human qPCR Primer Pair (NM_178014)
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.