beta V Tubulin (TUBB) Human qPCR Primer Pair (NM_178014)

SKU HP218747

qSTAR qPCR primer pairs against Homo sapiens gene TUBB

Product Data

• Locus ID: 203068
• Forward Sequence: CTGGACCGCATCTCTGTGTACT
• Reverse Sequence: GCCAAAAGGACCTGAGCGAACA
• ACCN: NM_178014, NM_178014.1, NM_178014.2, BC013374, BC013374.2, BC001002, BC001896, BC001938, BC002347, BC005838, BC007605, BC015889, BC019924, BC020946, BC021909, BC029323, BC062532, BC070326, BC103746, BE245819, BQ019614, BU557299, NM_178014.4
• UniProt ID: P07437
• Synonyms: CDCBM6; CSCSC1; M40; OK/SW-cl.56; TUBB1; TUBB5
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient