JPH1 Human qPCR Primer Pair (NM_020647)

SKU
HP213735
qSTAR qPCR primer pairs against Homo sapiens gene JPH1
$142.00
5 Days*
Specifications
Product Data
Locus ID 56704
Forward Sequence CTGTCACCTGATTTCTACCAACC
Reverse Sequence GGAGACTCCTTTGGTGTAGGTG
ACCN NM_020647, NM_020647.2, NM_020647.3, BC017980, BC049372, BC098299, BC098314, BC099736, BC113856, BC114464, BC139832, BC140875, BC140876, BU687964, BX537756, NM_020647.4
UniProt ID Q9HDC5
Synonyms CMT2K; JP-1; JP1
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Write Your Own Review
You're reviewing:JPH1 Human qPCR Primer Pair (NM_020647)
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.