ZNF44 Human qPCR Primer Pair (NM_016264)
$142.00
5 Days*
Product Data | |
Locus ID | 51710 |
---|---|
Forward Sequence | GTGATGCGAGAAACCATTAGGAAC |
Reverse Sequence | CCTTGGATTTCTCCTGAGATTTTG |
ACCN | BC032246, NM_016264, NM_016264.1, NM_016264.2, NM_016264.3, BC001868, BC136502, BE766488, BX640705, NM_016264.4 |
UniProt ID | P15621 |
Synonyms | GIOT-2; KOX7; ZNF; ZNF55; ZNF58; ZNF504 |
Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Shipping | Ambient |
Write Your Own Review
Product Manuals |
FAQs |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.